My article from this morning on Scientific American Guest Blogs
Living Interplanetary Space Flight Experiment–or Why Were All the Strange Creatures on the Shuttle Endeavour? by David Warmflash
Wednesday, June 1, 2011
Scientific American Guest Blogs Living Interplanetary Space Flight Experiment–or Why Were All the Strange Creatures on the Shuttle Endeavour?
Tuesday, May 31, 2011
How the Space Shuttle Endeavour got Her British Name
How many times has this happened to you? You're writing an article, or a blog entry, or a tweet about the space shuttle that is on her way home from her final flight as the STS-134 mission comes to an end. Next thing you know, you've typed the name "Endeavor", instead of "Endeavour". "Damn autocorrect" usually gets you through the moment. For those of you in the UK, this has never been a problem, but here across the pond, it's been a recurring experience for the last 15 days.
But did you ever wonder why NASA's fifth orbiting space shuttle acquired her name with the British spelling? 10 seconds of research on this topic lead me to the orbiter information page on the NASA Kennedy Space Center website. And therein lies the answer:
NASA's Endeavour was named for the HMS Endeavour:
"Endeavour was named after a ship chartered to traverse the South Pacific in 1768 and captained by 18th century British explorer James Cook, an experienced seaman, navigator and amateur astronomer. He commanded a crew of 93 men, including 11 scientists and artists.
"Cook's main objective, tasked by the British Admiralty and the Royal Society, was to observe the Transit of Venus at Tahiti. This reading enabled astronomers to find the distance of the Sun from the Earth, which then could be used as a unit of measurement in calculating the parameters of the universe..."
The NASA article goes on:
"Cook's achievements on Endeavour were numerous, including the accurate charting of New Zealand and Australia and successfully navigating the Great Barrier Reef. Thousands of new plant specimens and animal species were observed and illustrated on this maiden voyage. Cook also established the usefulness of including scientists on voyages of exploration."
So now we know. Time to add the British spelling to the computer's dictionary.
But did you ever wonder why NASA's fifth orbiting space shuttle acquired her name with the British spelling? 10 seconds of research on this topic lead me to the orbiter information page on the NASA Kennedy Space Center website. And therein lies the answer:
NASA's Endeavour was named for the HMS Endeavour:
"Endeavour was named after a ship chartered to traverse the South Pacific in 1768 and captained by 18th century British explorer James Cook, an experienced seaman, navigator and amateur astronomer. He commanded a crew of 93 men, including 11 scientists and artists.
"Cook's main objective, tasked by the British Admiralty and the Royal Society, was to observe the Transit of Venus at Tahiti. This reading enabled astronomers to find the distance of the Sun from the Earth, which then could be used as a unit of measurement in calculating the parameters of the universe..."
149 million kilometers, or 93 million miles from Earth. This is equal to about eight light minutes, which is to say that it takes light eight minutes to travel from the surface of the Sun to Earth. The second planet from the Sun, just slightly less massive than Earth, and the closest planet to Earth, Venus is called Earth’s sister planet. Despite the proximity, due to the thick cloud layer in the Venusian atmosphere, humanity would know nothing about the environment at the surface of Venus until the advent of space probes in the middle of the 20th century. But the basics of her movement around the Sun, and the distances between the Sun, Venus, and Earth were worked out based on the measurements taken by the scientists on Cook’s voyage.
The NASA article goes on:
"Cook's achievements on Endeavour were numerous, including the accurate charting of New Zealand and Australia and successfully navigating the Great Barrier Reef. Thousands of new plant specimens and animal species were observed and illustrated on this maiden voyage. Cook also established the usefulness of including scientists on voyages of exploration."
So now we know. Time to add the British spelling to the computer's dictionary.
Monday, May 30, 2011
LIFE Experiment to Return to Earth when Space Shuttle Endeavour's Last Flight Touches Down
Adapted from The Planetary Society's pre-mission press release
Late Sunday night, the space shuttle Endeavour undocked from the International Space Station. Commanded by Mark Kelly, husband of Congresswoman Gabriella Giffords, the Endeavour is carrying not only human astronauts but a legion of microscopic passengers in the Planetary Society's Shuttle LIFE experiment. Landing is scheduled for 2:32 am Wednesday at NASA's Kennedy Space center, in Florida.
Can life naturally transfer from planet to planet? LIFE, the Living Interplanetary Flight Experiment, was developed to test aspects of the transpermia hypothesis -- the ability of microbial life to survive an interplanetary voyage. The largest of the LIFE organisms launching on the shuttle will be tardigrades, or water bears, which are no bigger than the head of a pin.
Shuttle-LIFE will serve as a test run for Phobos LIFE, a larger collection of organisms that the Planetary Society will send on a three-year trip aboard a Russian spacecraft to the Martian moon Phobos and back to Earth in a capsule that will simulate a meteoroid. Phobos LIFE is set to launch at the end of 2011.
"One cannot help but wonder if it's possible for a living organism to make the trip from one planet to another?" said Bill Nye, Executive Director of the Planetary Society. "How about from Mars to the Earth?"
Shuttle LIFE's Main Goals
* Testing the effects of low Earth orbit spaceflight on the organisms,
* Providing a comparison for the upcoming long duration Phobos LIFE mission,
* Serving as a "dress rehearsal" for Phobos-LIFE, complete with loading, unloading, and analyzing organisms in laboratory conditions, and
* Engaging the public in the exciting discussion of whether life might be able to travel naturally between planets.
Over 16 days, Shuttle-LIFE has been testing the effects of low-Earth orbit spaceflight on five diverse species of microorganisms packed in tiny, heat-sealed, Delrin plastic sample tubes. For the Phobos mission, the miniature sample tubes will be packed into a nearly indestructible titanium capsule that looks like a small hockey puck.
The five life forms being flown in Shuttle-LIFE are Tardigrades; the bacteria Deinococcus radiodurans and Bacillus subtilis; and the archaea Haloarcula marismortui and Pyrococcus furiosus. A passenger manifest explains what characteristics of the different microorganisms - such as resistance to radiation or extreme hardiness - made them good choices for space travel.
"The millions of tiny space voyagers in Shuttle-LIFE are set to take a big journey and give us information about life in space, and they'll do it all without any checked baggage," said Bruce Betts, the Planetary Society's Director of Projects.
Partners For Shuttle LIFE
Partners on Shuttle LIFE, who will be providing organisms and pre and post flight analyses, are a team at ATCC in Manassas, Virginia led by Tim Lilburn and Amy Smith; Ingemar Joensson at Kristianstad University in Sweden; and a German DLR team, led by Petra Rettberg and Marko Wassmann. Phobos LIFE science Principal Investigator David Warmflash from Portland State University is involved with the science planning and analysis. Sample tubes were produced by Lindel Engineering in Tucson, Arizona based on designs by Bud Fraze.
Shuttle LIFE will fly in a flight-proven unit from Instrumentation Technology Associates, Inc. (ITA) as part of CREST-1 (Commercial Reusable Experiments for Science & Technology), manifested on STS-134 through NanoRacks LLC, working in partnership with NASA.
The Planetary Society:
The Planetary Society has inspired millions of people to explore other worlds and seek other life. Today, its international membership makes the non-governmental Planetary Society the largest space interest group in the world. Carl Sagan, Bruce Murray and Louis Friedman founded The Planetary Society in 1980. Bill Nye, a long time member of the Planetary Society's Board, is now the Executive Director.
Monday, May 23, 2011
Radionuclide Imaging to Assess Function of the Heart
Elements and molecules that emit ionizing radiation are known as radionuclides. This radioactivity is in the form of subatomic particles or gamma rays. Depending on the type of radioactive emission and other characteristics of the compound, different agents can be used for different purposes. In scintigraphy, radiation from radionuclides introduced into a patient are detected by special sensors called gamma cameras. The data then are processed to create two-dimensional images. In SPECT, sensors are arranged in a variety of positions around the patient and data are processed into 3 dimensional images.
In positron emission tomography (PET), the radionuclide is a compound that the body uses -which is to say a metabolite- that has been altered to include an atom that emits positrons. A positron is a subatomic particle that has the same mass as an electron, but is positively charged. It is the antimatter counterpart of an electron. When a positron is emitted and meets up with electrons from other sources, annihilation of both particles takes place and they are converted into gamma rays according to Einstein’s equation E = MC^2.
Cardiac radionuclide imaging uses radionuclides along with gamma cameras to obtain information on the function of the heart. It can be used clinically to diagnose and assess various medical conditions. In cardiac imaging, radionuclides are introduced into the body by injection. Gamma radiation, produced directly by the radionuclides or indirectly as a result of their presence, is then detected by special sensors. Data are then processed to produce an image.
Radionuclides used in cardiac imaging include technetium-99 and thallium-201. The number following the name of the element represents the total of the number of protons and neutrons in the nucleus of the element's atoms. Radionuclides can be useful in assessing various aspects of cardiac function. The flow of blood through the heart muscle (myocardium) can be tracked as the sensors, known as gamma cameras (cameras that detect gamma rays), track radiation from the radionuclide flowing in myocardial blood vessels. Coronary artery disease can be evaluated as well. In this case the flow of radionuclides, and therefore the blood, is tracked through the coronary arteries, the main blood vessels that nourish the heart. Similarly, the extent of damage to the heart following a myocardial infarction (interruption of blood flow to an area of the heart muscle) can be evaluated, as can the improvement of blood flow following coronary artery bypass surgery (CABG). Together with electrocardiography (ECG) radionuclides also can be used to assess how well the heart muscle moves.
In positron emission tomography (PET), the radionuclide is a compound that the body uses -which is to say a metabolite- that has been altered to include an atom that emits positrons. A positron is a subatomic particle that has the same mass as an electron, but is positively charged. It is the antimatter counterpart of an electron. When a positron is emitted and meets up with electrons from other sources, annihilation of both particles takes place and they are converted into gamma rays according to Einstein’s equation E = MC^2.
Cardiac radionuclide imaging uses radionuclides along with gamma cameras to obtain information on the function of the heart. It can be used clinically to diagnose and assess various medical conditions. In cardiac imaging, radionuclides are introduced into the body by injection. Gamma radiation, produced directly by the radionuclides or indirectly as a result of their presence, is then detected by special sensors. Data are then processed to produce an image.
Radionuclides used in cardiac imaging include technetium-99 and thallium-201. The number following the name of the element represents the total of the number of protons and neutrons in the nucleus of the element's atoms. Radionuclides can be useful in assessing various aspects of cardiac function. The flow of blood through the heart muscle (myocardium) can be tracked as the sensors, known as gamma cameras (cameras that detect gamma rays), track radiation from the radionuclide flowing in myocardial blood vessels. Coronary artery disease can be evaluated as well. In this case the flow of radionuclides, and therefore the blood, is tracked through the coronary arteries, the main blood vessels that nourish the heart. Similarly, the extent of damage to the heart following a myocardial infarction (interruption of blood flow to an area of the heart muscle) can be evaluated, as can the improvement of blood flow following coronary artery bypass surgery (CABG). Together with electrocardiography (ECG) radionuclides also can be used to assess how well the heart muscle moves.
Canine Osteosarcoma: Bone Cancer in Dogs
Although many types of bone cancer can develop in dogs, osteosarcoma (OSA) is the most common one. Usually occurring in the legs, osteosarcoma represents about 75-80 percent of malignant canine bone tumors, though less than five percent of canine tumors overall. Osteosarcoma tends to develop in the legs, possibly because it develops from cells that are involved in the manufacture of new bone, a process that occurs more often and more rapidly in long bones. Nevertheless, osteosarcoma may also develop elsewhere, such as in the spine, bones of the cranium, and rib cage. The incidence of osteosarcoma is higher in larger dog breeds than smaller dogs. Though it may appear in a dog of any age, osteosarcoma tends to affect older dogs, which is in sharp contrast with human osteosarcoma which usually strikes children and young adults, the most famous case being Ted Kennedy Jr. (son of the late Senator Ted Kennedy), who survived, but lost his leg to the disease.
Basic Definitions: Tumors, Cancer, Benign, Malignant, Metastasis, Sarcoma, Carcinoma
The word tumor refers to a growth that is abnormal compared to the surrounding tissue. Abnormally rapid and uncontrolled reproduction of cells can lead either to a benign tumor, or a malignant tumor. Malignant tumors are those which are more aggressive, do more hard to the tissue in which they are located, and usually (although there are a few exceptions) have a high chance of metastasis -spreading to remote areas of the body and seeding new tumors there. A sarcoma is a malignant tumor that develops either in connective tissue (which includes bone and cartilage tissue among others), or in muscle tissue. A carcinoma is a malignant tumor that develops in epithelial tissue, the type of tissue which lines surfaces. Since bones have epithelial tissue as part of their lining, carcinomas as well as sarcomas are possible.
Types of Malignant Tumors that can occur in Canine Bones
Osteosarcoma, the most common bone cancer, develops from cells that essentially are cousins of the cells that manufacture the bone material itself, the cells known as osteoblasts. Although sometimes dog owners are told osteoblasts actually produce the cancer, this is not exactly true. In fact, there are several subcategories of osteosarcoma, including osteoblastic, chondroblastic, fibroblastic, and many more. These are names of different types of cells that are present in bone, and the tumors are named accordingly. If the cells of a tumor look like osteoblasts, it is called osteoblastic. If they look like chondroblasts -the cells which produce cartilage- it is called chondroblastic, and so on. It is known, however, that sarcomas in bone result not from osteoblasts, chondroblasts, and the others per se, but from the stem cells that produce them. Stem cells are generalized cells which can develop into various cell types. In bone and cartilage, one type of stem cell that is present during development of the embryo can develop into several connective cell types as it reproduces. If cell reproduction goes a certain way, osteoblasts are produced. If it goes another way, chondroblasts are produced. But if a line of stem cells is somewhere along the way to producing osteoblasts and something goes wrong, cancer cells may be produce that look a lot like osteoblasts, but don’t act like osteoblasts. This is why it is more correct to say that the cells of osteoblastic osteosarcoma are cousins of the bone-making cells that we call osteoblasts.
Now, chondrosarcoma is the second most common malignant tumor that can develop in dog bones. As you may have guessed from the name, chondrosarcoma is a sarcoma of cartilage cells. Though less common than osteosarcoma, it is nearly as aggressive. As in the case of osteosarcoma, the diseased cells all begin as the same type of stem cells that also produced healthy osteoblasts and chondroblasts and a variety of other cells. Chondrosarcoma tends to occur in flat bones and the rib cage, since these are places where there is more cartilage compared to bone, in contrast to long bones which have cartilage concentrated at the ends. Sarcomas of different types can occur in other areas of bone too, for instance in the linings of joint capsules. Hemangiosarcoma and fibrosarcoma are two other sarcomas that can develop in dog bones. In the case of carcinomas, a subtype called squamous cell carcinoma can develop in the outer cell layer of canine bones, known as the periosteum. But again, bone cancer in dogs most often means osteosarcoma.
Etiology of Canine Osteosarcoma
What causes osteosarcoma, both in humans and dogs? Nobody is exactly sure, though many have speculated about possible mechanisms. Some have hypothesized cell damage due to ionizing radiation or carcinogenic chemicals as a possible causes. Nutritional factors have been studied, since the tumor usually develops near the region of the long bones where growth takes place (the growth plates). Other possibilities include trauma to the bones, and damage resulting from implants. Studies have been conducted to determine whether hormonal factors may be at play, perhaps in connection with neutering of the dogs. Genetic predisposition is another possibility; the presence of abnormal copies of a gene known as p53, which normally inhibits tumor development, correlates with increased osteosarcoma incidence.
Presentation and Diagnosis of Canine Osteosarcoma
Osteosarcoma in dogs typically presents as swelling, not always with pain initially, though pain will develop at some point. The dog is lame in the affected leg. The leg may fracture. On account of the pain, the dog will lose his or her appetite and lose weight, become lethargic, and often develop insomnia and be generally irritable. Unfortunately, by the time these symptoms appear, the tumor already has destroyed much of the bone in which it began. Even worse, in more than 90 percent of cases, the tumor already has metastasized to other bones and to the lungs.
X-rays can reveal visual features that are typical of an osteosarcoma in a bone. Together with clinical signs, usually this is enough to confirm a diagnosis. If needed though, a biopsy can be taken. In biopsy. a sample of the tumor is removed surgically, then examined by a pathologist.
Treatments for Canine Osteosarcoma
If osteosarcoma is detected early, there are treatments that not only can extend a dog’s life but can reduce the dog’s suffering. The treatments include surgery and chemotherapy, which usually means that the limb is amputated, followed by chemotherapy. If the cancer is in an early stage, amputation can actually save the dog’s life by preventing it from metastasizing to other parts of the body. Approximately 60 percent of dogs treated with amputation and chemotherapy for osteosarcoma are alive one year later, and forty percent two years later. In unusual cases in which only a tiny, isolated part of a bone is affected, it is possible to remove the tumor without amputation. Radiation treatment is used only to shrink an osteosarcoma in cases when it is so big that surgery is not possible.
Basic Definitions: Tumors, Cancer, Benign, Malignant, Metastasis, Sarcoma, Carcinoma
The word tumor refers to a growth that is abnormal compared to the surrounding tissue. Abnormally rapid and uncontrolled reproduction of cells can lead either to a benign tumor, or a malignant tumor. Malignant tumors are those which are more aggressive, do more hard to the tissue in which they are located, and usually (although there are a few exceptions) have a high chance of metastasis -spreading to remote areas of the body and seeding new tumors there. A sarcoma is a malignant tumor that develops either in connective tissue (which includes bone and cartilage tissue among others), or in muscle tissue. A carcinoma is a malignant tumor that develops in epithelial tissue, the type of tissue which lines surfaces. Since bones have epithelial tissue as part of their lining, carcinomas as well as sarcomas are possible.
Types of Malignant Tumors that can occur in Canine Bones
Osteosarcoma, the most common bone cancer, develops from cells that essentially are cousins of the cells that manufacture the bone material itself, the cells known as osteoblasts. Although sometimes dog owners are told osteoblasts actually produce the cancer, this is not exactly true. In fact, there are several subcategories of osteosarcoma, including osteoblastic, chondroblastic, fibroblastic, and many more. These are names of different types of cells that are present in bone, and the tumors are named accordingly. If the cells of a tumor look like osteoblasts, it is called osteoblastic. If they look like chondroblasts -the cells which produce cartilage- it is called chondroblastic, and so on. It is known, however, that sarcomas in bone result not from osteoblasts, chondroblasts, and the others per se, but from the stem cells that produce them. Stem cells are generalized cells which can develop into various cell types. In bone and cartilage, one type of stem cell that is present during development of the embryo can develop into several connective cell types as it reproduces. If cell reproduction goes a certain way, osteoblasts are produced. If it goes another way, chondroblasts are produced. But if a line of stem cells is somewhere along the way to producing osteoblasts and something goes wrong, cancer cells may be produce that look a lot like osteoblasts, but don’t act like osteoblasts. This is why it is more correct to say that the cells of osteoblastic osteosarcoma are cousins of the bone-making cells that we call osteoblasts.
Now, chondrosarcoma is the second most common malignant tumor that can develop in dog bones. As you may have guessed from the name, chondrosarcoma is a sarcoma of cartilage cells. Though less common than osteosarcoma, it is nearly as aggressive. As in the case of osteosarcoma, the diseased cells all begin as the same type of stem cells that also produced healthy osteoblasts and chondroblasts and a variety of other cells. Chondrosarcoma tends to occur in flat bones and the rib cage, since these are places where there is more cartilage compared to bone, in contrast to long bones which have cartilage concentrated at the ends. Sarcomas of different types can occur in other areas of bone too, for instance in the linings of joint capsules. Hemangiosarcoma and fibrosarcoma are two other sarcomas that can develop in dog bones. In the case of carcinomas, a subtype called squamous cell carcinoma can develop in the outer cell layer of canine bones, known as the periosteum. But again, bone cancer in dogs most often means osteosarcoma.
Etiology of Canine Osteosarcoma
What causes osteosarcoma, both in humans and dogs? Nobody is exactly sure, though many have speculated about possible mechanisms. Some have hypothesized cell damage due to ionizing radiation or carcinogenic chemicals as a possible causes. Nutritional factors have been studied, since the tumor usually develops near the region of the long bones where growth takes place (the growth plates). Other possibilities include trauma to the bones, and damage resulting from implants. Studies have been conducted to determine whether hormonal factors may be at play, perhaps in connection with neutering of the dogs. Genetic predisposition is another possibility; the presence of abnormal copies of a gene known as p53, which normally inhibits tumor development, correlates with increased osteosarcoma incidence.
Presentation and Diagnosis of Canine Osteosarcoma
Osteosarcoma in dogs typically presents as swelling, not always with pain initially, though pain will develop at some point. The dog is lame in the affected leg. The leg may fracture. On account of the pain, the dog will lose his or her appetite and lose weight, become lethargic, and often develop insomnia and be generally irritable. Unfortunately, by the time these symptoms appear, the tumor already has destroyed much of the bone in which it began. Even worse, in more than 90 percent of cases, the tumor already has metastasized to other bones and to the lungs.
X-rays can reveal visual features that are typical of an osteosarcoma in a bone. Together with clinical signs, usually this is enough to confirm a diagnosis. If needed though, a biopsy can be taken. In biopsy. a sample of the tumor is removed surgically, then examined by a pathologist.
Treatments for Canine Osteosarcoma
If osteosarcoma is detected early, there are treatments that not only can extend a dog’s life but can reduce the dog’s suffering. The treatments include surgery and chemotherapy, which usually means that the limb is amputated, followed by chemotherapy. If the cancer is in an early stage, amputation can actually save the dog’s life by preventing it from metastasizing to other parts of the body. Approximately 60 percent of dogs treated with amputation and chemotherapy for osteosarcoma are alive one year later, and forty percent two years later. In unusual cases in which only a tiny, isolated part of a bone is affected, it is possible to remove the tumor without amputation. Radiation treatment is used only to shrink an osteosarcoma in cases when it is so big that surgery is not possible.
Labels:
benign,
bone,
bone cancer,
bone cancer treatment,
bones,
Canine osteosarcoma,
carcinoma,
cartilage,
chondrosarcoma,
connective tissue,
dog,
malignant,
osteosarcoma,
p53,
radiation,
sarcoma
Authorship of the Hebrew Bible
Although, traditionally, authorship of the Torah, is ascribed to Moses, and the various books of the prophets (Nevi’im) to the prophets themselves or in some cases to scribes working directly with them, the Genesis-Kings core of the Hebrew Bible does not actually make a point as to who wrote its parts. Even Deuteronomy, which is framed in the Torah as a recounting of Moses’ own words, is presented from the perspective of a narrator writing prose around poetic speeches attributed to Moses. As numerous people have observed throughout the centuries, Deuteronomy even describes Moses’ death and speaks of him as the humblest man who ever lived. This is not something that the humblest man who ever lived would have written about himself.
Many centuries prior to the emergence of the Documentary Hypothesis, Jewish scholars had observed this conflict with the assumption that Moses’ had written the Torah. Thus, in medieval Spain, Ibn Ezra advised those who “understood” to “remain silent”.
Richard Ellior Friedman’s books, particularly Who Wrote the Bible?, but also The Hidden Book on the Bible, are works of source criticism, but are fairly weak on historical criticism. Thus, while Friedman puts a lot of effort into which groups likely authored which source texts, his conclusions regarding the periods are based on relatively superficial analysis, assumptions that the united monarchy was completely historical, and ends of with a fairly wide window as to the time period for J and E (though he suggests that he began some research that would have narrowed the writing of E to the last 25 years of the of the kingdom of Samaria).
Furthermore, other scholars in Friedman's cohort don't agree with him on the dates. Baruch Halpern, who like Friedman did his doctoral work at Harvard under Frank Moore Cross in the 1970s, places the P author around 600 BCE. Additionally, using the evolution of the tribal structure of the branches of Judah as well as linguistic arguments, Halpern suggests that the CH had to proceed J by a century or so. Of course, this implies that Friedman cannot be right that J and the CH were the same man or woman, as he posits in The Hidden Book in the Bible.
Focusing on the intriguing possibility that Judahite palace women may played an important role in transcribing many oral traditions to written documents, Axel Knauf hypothesizes a court history evolving in stages with stories being told and rehashed under the guidance of the Queen-mothers Bathsheba, Maacah, and perhaps most importantly, Athalia, daughter of Ahab. While many scholars take at face value the contention by editors at least one point in the evolution of Kings that Athalia was an unpopular queen, Knauf essentially makes her a key figure in the creation of the official memory of David’s reign.
Many centuries prior to the emergence of the Documentary Hypothesis, Jewish scholars had observed this conflict with the assumption that Moses’ had written the Torah. Thus, in medieval Spain, Ibn Ezra advised those who “understood” to “remain silent”.
Richard Ellior Friedman’s books, particularly Who Wrote the Bible?, but also The Hidden Book on the Bible, are works of source criticism, but are fairly weak on historical criticism. Thus, while Friedman puts a lot of effort into which groups likely authored which source texts, his conclusions regarding the periods are based on relatively superficial analysis, assumptions that the united monarchy was completely historical, and ends of with a fairly wide window as to the time period for J and E (though he suggests that he began some research that would have narrowed the writing of E to the last 25 years of the of the kingdom of Samaria).
Furthermore, other scholars in Friedman's cohort don't agree with him on the dates. Baruch Halpern, who like Friedman did his doctoral work at Harvard under Frank Moore Cross in the 1970s, places the P author around 600 BCE. Additionally, using the evolution of the tribal structure of the branches of Judah as well as linguistic arguments, Halpern suggests that the CH had to proceed J by a century or so. Of course, this implies that Friedman cannot be right that J and the CH were the same man or woman, as he posits in The Hidden Book in the Bible.
Focusing on the intriguing possibility that Judahite palace women may played an important role in transcribing many oral traditions to written documents, Axel Knauf hypothesizes a court history evolving in stages with stories being told and rehashed under the guidance of the Queen-mothers Bathsheba, Maacah, and perhaps most importantly, Athalia, daughter of Ahab. While many scholars take at face value the contention by editors at least one point in the evolution of Kings that Athalia was an unpopular queen, Knauf essentially makes her a key figure in the creation of the official memory of David’s reign.
Labels:
Bathsheba,
Bible,
biblical scribes,
D author,
Deuteronomist,
Deuteronomistic,
documentary hypothesis,
E author,
Hebrew Bible,
J author,
King David,
King Solomon,
Torah,
Who Wrote the Bible?
Injured Calf Muscle: How the Muscle is Injured, Prevention and Treatment
The calf muscle muscle is the common name for the triceps surae muscles of the leg. These can be torn, detached, or or partly detected from the tendons that hold them to bones when the foot bent suddenly and with extensive force. The triceps surae actually comprises a pair of muscles whose role is to flex the foot. The two muscles are soleus and the gastrocnemius, both of which insert into the calcaneus bone (the bone of the heal) by way of the Achilles tendon. The Achilles tendon is named for Achilles, the Greek hero of Homeric fame.
Flexion is defined as the position that the foot takes when the toes are pointed. The opposite movement is called extension, which stretches the calf muscles and the Achilles tendon as well. Often, the meanings of flexion and extension of the foot are reversed in common language, particularly in the case of dancers. However, in medicine and anatomy this is not correct. To avoid confusion, flexion often is called plantarflexion, while extension is known as dorsiflexion. Thus, it is a fast or powerful extension, or dorsiflexion, of the foot which pulls the calf muscles to the point of causing injury.
Calf muscle injury can happen during sporting events. If a foot is dorsiflexed suddenly, such as might happen in landing an under-rotated back somersault on a very hard surface, the Achilles tendon is pulled. If the tendon itself is not damaged but the muscle rips away, the liberated parts of the muscle may curl up. This is known as muscle rupture, or collapse. Symptoms of this condition include pain in the back of the calf, pain when the foot is plantarflexed against resistance (somebody holding the foot to make plantarflexion more difficult), and severed tightness of the calf for several days.
The risk of injuring the triceps surae can be reduced by doing a good warmup prior to exercising, with stretches that include the triceps surae and other muscle groups of the lower extremities.
If you believe that you may have injured your triceps surae, you should consult with your physician, athletic trainer, or with somebody with expertise in sports medicine. Initial treatment should begin with what is known in sports medicine by the acronym RICE -rest, ice, compression, elevation. Sit or lie down and have somebody bring you ice or a cold pack and apply it to the injured muscle for at least fifteen minutes. This will help to reduce swelling. Swelling can be reduced further with the application of a compression bandage. This is a stretchy bandage that wraps around around the leg. Wrap it tightly enough to feel snug, but not so tight that cuts off circulation. Elevating the leg, slightly above the ground, also will help to reduce the swelling. Finally, it is very important to rest the muscle. Do this by avoiding activity that is physically stressful.
Flexion is defined as the position that the foot takes when the toes are pointed. The opposite movement is called extension, which stretches the calf muscles and the Achilles tendon as well. Often, the meanings of flexion and extension of the foot are reversed in common language, particularly in the case of dancers. However, in medicine and anatomy this is not correct. To avoid confusion, flexion often is called plantarflexion, while extension is known as dorsiflexion. Thus, it is a fast or powerful extension, or dorsiflexion, of the foot which pulls the calf muscles to the point of causing injury.
Calf muscle injury can happen during sporting events. If a foot is dorsiflexed suddenly, such as might happen in landing an under-rotated back somersault on a very hard surface, the Achilles tendon is pulled. If the tendon itself is not damaged but the muscle rips away, the liberated parts of the muscle may curl up. This is known as muscle rupture, or collapse. Symptoms of this condition include pain in the back of the calf, pain when the foot is plantarflexed against resistance (somebody holding the foot to make plantarflexion more difficult), and severed tightness of the calf for several days.
The risk of injuring the triceps surae can be reduced by doing a good warmup prior to exercising, with stretches that include the triceps surae and other muscle groups of the lower extremities.
If you believe that you may have injured your triceps surae, you should consult with your physician, athletic trainer, or with somebody with expertise in sports medicine. Initial treatment should begin with what is known in sports medicine by the acronym RICE -rest, ice, compression, elevation. Sit or lie down and have somebody bring you ice or a cold pack and apply it to the injured muscle for at least fifteen minutes. This will help to reduce swelling. Swelling can be reduced further with the application of a compression bandage. This is a stretchy bandage that wraps around around the leg. Wrap it tightly enough to feel snug, but not so tight that cuts off circulation. Elevating the leg, slightly above the ground, also will help to reduce the swelling. Finally, it is very important to rest the muscle. Do this by avoiding activity that is physically stressful.
Vitamin B-12 (Cobalamin): Basic Information on Molecular Structure and Metabolic Function
Vitamin B-12, also known as cobalamin, actually is a family of chemical compounds with a similar structure. The molecular structure common to all cobalamin compounds is a type of heterocyclic ring known as a corrin ring, which is similar to the porphyrin ring that is the basis of hemoglobin. But whereas most forms of the porphyrin ring bind an iron ion in the center, the corrin binds a cobalt ion (an atom of cobalt with an unbalanced electrical charge).
Forms of cobalamin include methylcobalamin, cyanocobalamin, adenosylcobalamin, and hydroxocobalamin. When an atom ion is attached to the corrin ring, four bonds are formed, each with a nitrogen atom on the ring. This leaves a fifth binding site on the cobalt. The type of cobalamin compound is determined by what chemical group is attached to the fifth binding site of the cobalt atom.
Methylcobalamin has a methyl group (CH3) attached to the fifth binding site of the cobalt atom. Cyanocobalamin has a cyanide group (CH), adenosylcobalamin has an adenosine (C10H13N5O4), and hydroxocobalamin has an hydroxide (OH) group attached to the fifth binding site of the cobalt.
Cabalamins all are water soluble. Methylcobalamin and adenosylcobalamin occur naturally and are produced by bacteria, including those in the human gut. Hydroxocobalamin also is produced by bacteria, but not inside the human body. However, such bacteria are used often to manufacture vitamin B-12. Cyanocobalamin is a synthetic form of vitamin B-12 that is included in many vitamin supplements and also is given therapeutically in higher doses for certain disorders.
When ingested into the body, cyanocobalamin and hydroxocobalamin are converted to methylcobalamin and adenosylcobalamin. Along with the vitamin B-12 produced in the gut by bacteria, cobalimins must bind with intrinsic factor which is produced by specialized cells of the stomach.
Cobalamins are involved in various metabolic reactions throughout the body, particularly in connection with the synthesis of DNA, which also is highly dependent on another compound, folic acid. Since the synthesis of blood cells in bone marrow requires an extremely high rate of DNA synthesis, one condition that can develop as when the body is deficient either in cobalamins or folic acid (or both) is megaloblastic anemia.
Megaloblastic anemia can be caused by a lack of vitamin B-12 or folic acid in the diet, but also may be caused by certain stomach ailments which interfere with the production of intrinsic factor. In the latter case, cobalimins cannot be absorbed through the intestines, resulting in a type of megaloblastic anemia known as pernicious anemia.
Forms of cobalamin include methylcobalamin, cyanocobalamin, adenosylcobalamin, and hydroxocobalamin. When an atom ion is attached to the corrin ring, four bonds are formed, each with a nitrogen atom on the ring. This leaves a fifth binding site on the cobalt. The type of cobalamin compound is determined by what chemical group is attached to the fifth binding site of the cobalt atom.
Methylcobalamin has a methyl group (CH3) attached to the fifth binding site of the cobalt atom. Cyanocobalamin has a cyanide group (CH), adenosylcobalamin has an adenosine (C10H13N5O4), and hydroxocobalamin has an hydroxide (OH) group attached to the fifth binding site of the cobalt.
Cabalamins all are water soluble. Methylcobalamin and adenosylcobalamin occur naturally and are produced by bacteria, including those in the human gut. Hydroxocobalamin also is produced by bacteria, but not inside the human body. However, such bacteria are used often to manufacture vitamin B-12. Cyanocobalamin is a synthetic form of vitamin B-12 that is included in many vitamin supplements and also is given therapeutically in higher doses for certain disorders.
When ingested into the body, cyanocobalamin and hydroxocobalamin are converted to methylcobalamin and adenosylcobalamin. Along with the vitamin B-12 produced in the gut by bacteria, cobalimins must bind with intrinsic factor which is produced by specialized cells of the stomach.
Cobalamins are involved in various metabolic reactions throughout the body, particularly in connection with the synthesis of DNA, which also is highly dependent on another compound, folic acid. Since the synthesis of blood cells in bone marrow requires an extremely high rate of DNA synthesis, one condition that can develop as when the body is deficient either in cobalamins or folic acid (or both) is megaloblastic anemia.
Megaloblastic anemia can be caused by a lack of vitamin B-12 or folic acid in the diet, but also may be caused by certain stomach ailments which interfere with the production of intrinsic factor. In the latter case, cobalimins cannot be absorbed through the intestines, resulting in a type of megaloblastic anemia known as pernicious anemia.
Phoenix, Viking, and the Search for Life on Mars
The Phoenix Lander was the first of NASA’s Scout class missions. It landed in the Martian arctic (the region around the Martian North Pole). The purpose of Phoenix was to study the history of water in the Martian arctic, and to examine the boundary between ice and regolith (the dirt on the Martian surface) to help to determine whether it might support life forms. The Phoenix mission did not make a direct search for life forms. Thus far, the only probes to search directly for the presence of life were NASA’s Viking 1 and Viking 2 landers (VL1 and VL2), sent to Mars in 1976. Costing a billion dollars each, VL1 and VL2 landed at Chryse Planitia and Utopia Planitia, respectively, two regions of Mars that were considered to be less risky for landing the probes due a lack of crevices, hills, or large boulders, which might have flipped the probes on landing.
From an astrobiology perspective, these sites also were considered to be less interesting than the icy poles, such as where Phoenix landed. Nevertheless, VL2 and VL2 transmitted interesting results. One instrument, called the Labeled Release (LR) Experiment, produced an analysis of regolith samples which seemed to indicate the presence of microorganisms. Because of the findings of other experiments, however, many scientists rethought the LR results and believed them to be the effect of some non-biological property of the regolith. New understanding of Mars gained over the last couple of decades, however, have cast some doubt on the rethinking, so that Martian microbes actually may prove to be a simpler explanation of the LR results, compared to proposed non-biological causes. Meanwhile, the LR Principal Investigator, Gilbert Levin, has maintained since 1976 that the LR did detect life on Mars. Today, many scientists have come to take all or some of Levin’s proposals seriously. This is due, in part, to an evolving understanding of the Martian environment with regard to water and organic compounds.
As far as organic material goes, back in the days of Viking, it was assumed that organics should exist on the Red Planet, since like Earth, Mars has been bombarded with comets and meteorites containing organic material from space. However, when an instrument carried by VL1 and VL2 known as the GCMS failed to identify organic material, people started to propose all sorts of mechanisms by which organic material could have been destroyed. Recently, however, the Phoenix lander identified perchlorate, whose presence would have turned any organic material sought by Viking into chlorinated organic compounds -which in fact the Viking GCMS devices did detect. Since these compounds were used as cleaning agents on the spacecraft prior to launch, the finding of chlorinated organic compounds by the Viking GCMS was thought to represent a false positive. Now, the entire story must be reassessed.
While the atmospheric pressure on Mars is much lower than it is on Earth, it is such that at the surface it is possible to have transient liquid water at certain times of the day, at certain times of the year. It also is possible for water to exist as liquid for long periods of time on Mars, provided that it is very salty water -a scenario that has been proposed to explain the observations that have been made in recent years, suggesting that water flowed on the surface of the Red Planet fairly recently, even though the atmospheric pressure at the surface is no more than 7 millibars. Analysis of meteorites that were catapulted from the Martian crust and made their way to Earth shows high levels of various salts in the rock, and so this hypothesis of briny seas and rivers on Mars of the past really makes a lot of sense. And if there was water, then probably life arose on Mars and still exists there today, since life is pretty tenacious and evolves to take advantage of changing environments.
At least one Mars meteorite, ALH84001, preserves fossils of microorganisms that lived on Mars billions of years ago. While several investigators have criticized biological interpretations of various features in the meterorite, in recent years, Dr. David McKay of NASA’s Johnson Space Center and his colleagues have countered with yet stronger evidence. Much of this evidence has to do with several features of crystals made of magnetite, which could have emerged only as a result of Darwinian selective processes that have been observed in nature only in connection with biology.
From an astrobiology perspective, these sites also were considered to be less interesting than the icy poles, such as where Phoenix landed. Nevertheless, VL2 and VL2 transmitted interesting results. One instrument, called the Labeled Release (LR) Experiment, produced an analysis of regolith samples which seemed to indicate the presence of microorganisms. Because of the findings of other experiments, however, many scientists rethought the LR results and believed them to be the effect of some non-biological property of the regolith. New understanding of Mars gained over the last couple of decades, however, have cast some doubt on the rethinking, so that Martian microbes actually may prove to be a simpler explanation of the LR results, compared to proposed non-biological causes. Meanwhile, the LR Principal Investigator, Gilbert Levin, has maintained since 1976 that the LR did detect life on Mars. Today, many scientists have come to take all or some of Levin’s proposals seriously. This is due, in part, to an evolving understanding of the Martian environment with regard to water and organic compounds.
As far as organic material goes, back in the days of Viking, it was assumed that organics should exist on the Red Planet, since like Earth, Mars has been bombarded with comets and meteorites containing organic material from space. However, when an instrument carried by VL1 and VL2 known as the GCMS failed to identify organic material, people started to propose all sorts of mechanisms by which organic material could have been destroyed. Recently, however, the Phoenix lander identified perchlorate, whose presence would have turned any organic material sought by Viking into chlorinated organic compounds -which in fact the Viking GCMS devices did detect. Since these compounds were used as cleaning agents on the spacecraft prior to launch, the finding of chlorinated organic compounds by the Viking GCMS was thought to represent a false positive. Now, the entire story must be reassessed.
While the atmospheric pressure on Mars is much lower than it is on Earth, it is such that at the surface it is possible to have transient liquid water at certain times of the day, at certain times of the year. It also is possible for water to exist as liquid for long periods of time on Mars, provided that it is very salty water -a scenario that has been proposed to explain the observations that have been made in recent years, suggesting that water flowed on the surface of the Red Planet fairly recently, even though the atmospheric pressure at the surface is no more than 7 millibars. Analysis of meteorites that were catapulted from the Martian crust and made their way to Earth shows high levels of various salts in the rock, and so this hypothesis of briny seas and rivers on Mars of the past really makes a lot of sense. And if there was water, then probably life arose on Mars and still exists there today, since life is pretty tenacious and evolves to take advantage of changing environments.
At least one Mars meteorite, ALH84001, preserves fossils of microorganisms that lived on Mars billions of years ago. While several investigators have criticized biological interpretations of various features in the meterorite, in recent years, Dr. David McKay of NASA’s Johnson Space Center and his colleagues have countered with yet stronger evidence. Much of this evidence has to do with several features of crystals made of magnetite, which could have emerged only as a result of Darwinian selective processes that have been observed in nature only in connection with biology.
Labels:
ALH84001,
astrobiology,
extraterrestrial life,
Mars,
Mars meterorites,
Martian life,
microbes,
microorganisms,
NASA,
organic material,
Phoenix,
Red Planet,
search for life,
Viking,
water on Mars
Radon Gas and Lung Cancer: the Controversy, and Should You Worry About Exposure in Your Home?
The late astronomer and science communicator, Carl Sagan, once wrote, "We live in a society exquisitely dependent on science and technology. We have also arranged things so that almost no one understands science and technology. This is a prescription for disaster." One of the many ways in which this observation plays out is a phenomenon that some have called "radiophobia", an irrational, disproportionate fear of radiation, which exists in many countries, but in the United States in particular. This is not to say that people avoid exposure to radiation beyond the background levels present where they live. Rather they tend to fear certain types of radiation exposure while not hesitating to be exposed to other types. The so called "natural" food industry has campaigned fiercely against irradiation of foods, even though studies have demonstrated that irradiation makes certain foods, meat in particular, safer. At no time do we encounter more fear of radiation exposure than during pregnancy. Or at least to radiation from medical sources. I have witnessed patients and obstetricians agreeing that it is best to avoid exposing a woman's fetus to the miniscule dose ionizing radiation given during radiography of the pelvis to check for cephalopelvic disproportion, thus to be sure whether or not a cesarian section will be necessary, yet both patient and clinician smiling as the woman remarks that she'll be taking an intercontinental flight in the next few weeks.
Somehow, the obstetrician did not know that the flight would expose the fetus to a dose of radiation several times higher than the pelvic X-ray would. Not the exposure on the flight would be dangerous to the fetus either; though you may be exposed to a chest X-ray worth of radiation every 1-3 hours in the air on a commercial flight (depending on altitude and the route), there is no evidence that such exposures cause cancer. This is in the category of low dose radiation exposure, not much higher than the doses to which you are exposed simply by walking around on Earth every day. Our cells have repair mechanisms, various enzyme systems whose job is to look for mistakes in DNA sequences and damage to cell structure and fix them when they are brought on by radiation. There is evidence from animal studies that these mechanisms are induced by exposure to low levels of radiation and that avoiding such exposures weakens the cellular response to higher levels.
Most people are a little confused about what ionizing radiation is, an example of of Sagan's observation that society does not understand science and technology. But even those who were able to get through high school, college, and graduate school without taking any class in physics may recall from high school biology something about the effects of sunlight on skin cells. True, we have been inundated with warnings about Sun exposure and recommendations to use sunscreen. Nevertheless, you may recall that exposure to a type of solar radiation known as ultraviolet light stimulates cells known as melanocytes to produce melanin. This tans your skin and in doing so reduces the amount of ultraviolet light that can reach skin cells. It is an adaptive response, and it is protective, which is one reason why a little bit of sunlight every day, without sunscreen, is good for you (another reason is that it enables your cells to synthesize vitamin D).Perhaps, because society never was faced with movies in the 1950s about mutant giants being created as a result of heavy sunlight exposure, society does not fear radiation from the Sun the way it fears it from other radiation sources, like nuclear reactors.
Now, if you're in the process of buying a home, or moving into a home, or trying to make a very old home safer, it is likely that you are thinking a lot about radon. Unlike the Environmental Protection Agency (EPA) -which I suspect is going to change its mind on radon at some point (the question is just "when?")- I'm going to tell you that the question of whether radon causes lung cancer is very complicated and nuanced. Having read through the scientific literature regarding radon in homes and in mines, lung cancer, smokers vs. nonsmokers, and all of that, I'm rather startled that the EPA is so convinced that the levels of radon present in many homes in the United States causes lung cancer, because the evidence just isn't there. Yes, there have been several studies published during the last 15 years drawing such a conclusion, but they all use extrapolation as the method by which they arrive at their conclusion that the concentration of radon gas in the air of homes should be made as low as reasonably achievable.
What types of studies are we talking about? Essentially, all of the studies concluding that the levels of radon present in many homes cause lung cancer use data that come from men working underground in mines, where radon levels are ten times or more what they are in most homes. Eliminating the contribution of smoking, which of course causes most cases of lung cancer, various analyses have made it very clear that high levels of radon gas cause lung cancer, just as high levels of other types of radiation certain do cause various other cancers, including lung. Extrapolating backward from high doses to conclude that if high doses of radiation cause a lot of cancer then low doses of the same radiation must cause a little bit of cancer is known in epidemiology as the linear no-threshold model. It means that not matter how low the radiation dose gets, it always is bad. But in the mid 1990s the radiation physicist, Bernard Cohen, of the University of Pittsburgh, published a meta-analysis based on eight different epidemiological studies, using data low dose exposures. What Cohen found was that once you get below a certain concentration of radon, the association between exposure and cancer is not linear. Instead what happens, Cohen found, is that while the lung cancer rate goes down in a linear fashion as the concentration of radiation from radon decreases on the order of dozens of picocuries/liter (pCi/L), once you get below 8 pCi/L, the lung cancer death rate goes up again, suggesting that radon exposure in this range actually helps to prevent lung cancer rather than causing it. If correct, this would be an example of radiation hormesis, the phenomenon in which small doses of radiation act to prevent the same cancer than higher doses would cause.
The EPA recommends reducing levels of radon in the home to below 4 pCi/L, relying on those indirect, extrapolation studies, using data from high dose exposure in mines, and despite Cohen's findings which depended on actual low dose exposure data. If Cohen is correct then spending all of the time and money to clear homes of such levels actually would cause an increase in lung cancer incidence. On the other hand, Cohen's critics -many of the authors of the indirect studies- say that they do not agree with how he accounted for the smokers vs. the non-smokers in the studies that went into the meta-analysis. They may have a point, although they do not explain very well why they think that smokers are exposed to less radon than non-smokers. But whether they are right or wrong about the smoking issue, there still are no data to support their studies, which means that Cohen may very well turn out to be correct.
Somehow, the obstetrician did not know that the flight would expose the fetus to a dose of radiation several times higher than the pelvic X-ray would. Not the exposure on the flight would be dangerous to the fetus either; though you may be exposed to a chest X-ray worth of radiation every 1-3 hours in the air on a commercial flight (depending on altitude and the route), there is no evidence that such exposures cause cancer. This is in the category of low dose radiation exposure, not much higher than the doses to which you are exposed simply by walking around on Earth every day. Our cells have repair mechanisms, various enzyme systems whose job is to look for mistakes in DNA sequences and damage to cell structure and fix them when they are brought on by radiation. There is evidence from animal studies that these mechanisms are induced by exposure to low levels of radiation and that avoiding such exposures weakens the cellular response to higher levels.
Most people are a little confused about what ionizing radiation is, an example of of Sagan's observation that society does not understand science and technology. But even those who were able to get through high school, college, and graduate school without taking any class in physics may recall from high school biology something about the effects of sunlight on skin cells. True, we have been inundated with warnings about Sun exposure and recommendations to use sunscreen. Nevertheless, you may recall that exposure to a type of solar radiation known as ultraviolet light stimulates cells known as melanocytes to produce melanin. This tans your skin and in doing so reduces the amount of ultraviolet light that can reach skin cells. It is an adaptive response, and it is protective, which is one reason why a little bit of sunlight every day, without sunscreen, is good for you (another reason is that it enables your cells to synthesize vitamin D).Perhaps, because society never was faced with movies in the 1950s about mutant giants being created as a result of heavy sunlight exposure, society does not fear radiation from the Sun the way it fears it from other radiation sources, like nuclear reactors.
Now, if you're in the process of buying a home, or moving into a home, or trying to make a very old home safer, it is likely that you are thinking a lot about radon. Unlike the Environmental Protection Agency (EPA) -which I suspect is going to change its mind on radon at some point (the question is just "when?")- I'm going to tell you that the question of whether radon causes lung cancer is very complicated and nuanced. Having read through the scientific literature regarding radon in homes and in mines, lung cancer, smokers vs. nonsmokers, and all of that, I'm rather startled that the EPA is so convinced that the levels of radon present in many homes in the United States causes lung cancer, because the evidence just isn't there. Yes, there have been several studies published during the last 15 years drawing such a conclusion, but they all use extrapolation as the method by which they arrive at their conclusion that the concentration of radon gas in the air of homes should be made as low as reasonably achievable.
What types of studies are we talking about? Essentially, all of the studies concluding that the levels of radon present in many homes cause lung cancer use data that come from men working underground in mines, where radon levels are ten times or more what they are in most homes. Eliminating the contribution of smoking, which of course causes most cases of lung cancer, various analyses have made it very clear that high levels of radon gas cause lung cancer, just as high levels of other types of radiation certain do cause various other cancers, including lung. Extrapolating backward from high doses to conclude that if high doses of radiation cause a lot of cancer then low doses of the same radiation must cause a little bit of cancer is known in epidemiology as the linear no-threshold model. It means that not matter how low the radiation dose gets, it always is bad. But in the mid 1990s the radiation physicist, Bernard Cohen, of the University of Pittsburgh, published a meta-analysis based on eight different epidemiological studies, using data low dose exposures. What Cohen found was that once you get below a certain concentration of radon, the association between exposure and cancer is not linear. Instead what happens, Cohen found, is that while the lung cancer rate goes down in a linear fashion as the concentration of radiation from radon decreases on the order of dozens of picocuries/liter (pCi/L), once you get below 8 pCi/L, the lung cancer death rate goes up again, suggesting that radon exposure in this range actually helps to prevent lung cancer rather than causing it. If correct, this would be an example of radiation hormesis, the phenomenon in which small doses of radiation act to prevent the same cancer than higher doses would cause.
The EPA recommends reducing levels of radon in the home to below 4 pCi/L, relying on those indirect, extrapolation studies, using data from high dose exposure in mines, and despite Cohen's findings which depended on actual low dose exposure data. If Cohen is correct then spending all of the time and money to clear homes of such levels actually would cause an increase in lung cancer incidence. On the other hand, Cohen's critics -many of the authors of the indirect studies- say that they do not agree with how he accounted for the smokers vs. the non-smokers in the studies that went into the meta-analysis. They may have a point, although they do not explain very well why they think that smokers are exposed to less radon than non-smokers. But whether they are right or wrong about the smoking issue, there still are no data to support their studies, which means that Cohen may very well turn out to be correct.
To Sleep, Per Chance to Dream: How Hormones Affect Sleep in the Pregnant Woman
So you found out recently that you're pregnant, but now you're sleepy throughout the day, and yet having trouble falling asleep at night? Could it be the excitement? Thinking about the baby that you'll have in several months, maybe you stay up late thinking of names. Well, if that is the case, probably it doesn't have much to do with why you don't sleep. Does insomnia (having trouble falling asleep or staying asleep) have something to do with why you get sleepy during the day. Absolutely. But the reason is not only because of the quantity of sleep; it's also the quality. It has to do with hormones and how they affect sleep physiology.
Let's run through the basics. Sleep is a normal function in most animals. Birds, fish, and mammals (which include humans) all do it. It helps the body to grow new tissue, to repair damage, and to rest. Sleep occurs in stages. Stages 1, 2, and 3 are known as non-REM, or NREM, sleep. The other stage is rapid eye movement, or REM sleep. This is the stage during which most dreaming takes place. The stages occur in a cycle, with 1,2,3, and REM cycling through the night, the amount of time in REM sleep increasing with each cycle.
Pregnancy is one of the times when the body does a great deal of growing. Pregnant or not, if you lose some sleep, you can function, drink coffee to compensate, and make up for the loss over the next night or two. But sleep deprivation day after day makes you sick, and extreme deprivation of sleep even can lead to death. Various studies published between 2007 and 2010 have demonstrated an association between lack of sleep and hypertension -high blood pressure- a major risk factor in heart disease and strokes, the first and third leading causes of death, respectively, in the United States.
Generally, six hours per night is cited as the minimum amount of sleep that most adults need to remain healthy. It is clear that many people need somewhat more than this; it is not so clear that people who claim that five hours per night is enough for them are correct. Most sleep experts agree that if you are pregnant you should get closer to eight hours. That is, if you can. Upon learning of their pregnancy usually a few weeks into the first trimester, many women find that they are not sleeping as well as they did before.
The reason for this is hormonal. During a normal menstrual cycle, the hormones estrogen and progesterone rise and fall in a certain pattern, both hormones being at a low at menstruation. If fertilization takes place, then of course you do not menstruate, but then what happens is that the levels of both hormones begin to rise and climb throughout pregnancy. The interplay between the various hormones and sleep is complex and not understood completely, but a lot is known.
Having a lack of estrogen, for example, is known to contribute to a disorder called sleep apnea, a condition in which breathing is interrupted frequently while sleeping, which also interrupts sleep so that the person doesn't sleep well and is sleepy during the day. Progesterone seems to promote sleep, suggesting that women actually should sleep better as the levels rise throughout pregnancy. Why is this not the case? It turns out that while progesterone makes a woman sleepy in general, it actually may decrease the amount of REM sleep, so that the overall quality of sleep suffers. The implication is that pregnant women would not dream as much as perhaps they ought to dream.
But there is another hormone involved and that is melatonin. Unlike estrogen and progesterone, melatonin is present in women as well as men. We all use it to go to sleep. It comes from the pineal gland in the brain and its release pattern depends of the cycles of light and darkness. These cycles are known as circadian rhythms. When it gets dark at night, your pineal gland begins to send melatonin coursing through your blood stream. This makes you sleepy and keeps you asleep throughout the night. The only problem is that, in modern society, often we interrupt circadian rhythms when we fly quickly between multiple time zones, and also when we keep the lights on late into the night. Not only does this make it more difficult to fall asleep but seems to have been a factor at play in the increased incidence of certain cancers during the 20th century as the use of electric light bulbs increased.
Keeping the lights on at night in the hour or two before you go to bed prevents your pineal gland from releasing melatonin to put you to sleep. While the increased progesterone of pregnancy may help you to feel sleepy and may induce non-REM sleep, it also increases your need to urinate, thus waking you up. If you get the lights off and thus get your melatonin turned on, it doesn't take much to turn it off. Turning on a light, for instance to go to the bathroom, even for a couple of minutes, can stimulate your pineal gland to shut off. While this can be helpful in the morning so that the light wakes you up, in the middle of the night it can mean trouble.
Studies have shown that it can take a long time to turn your melatonin back on in the middle of the night once exposure to a small amount of light signals the pineal gland to turn it off. On the other hand, it turns out that not all light turns off your melatonin. Only light at wavelengths less than about 520 nanometers or so -light in the blue and partly into the green part of the light spectrum- turns it off. This means that the price of keeping you melatonin up throughout the night is not having to bump into walls or having to feel your way around in the dark go to the bathroom. It simply means that you need only avoid the blue-green light at night (and avoid white light, which includes all of the colors), replacing it with red light, yellow light, or orange light in the bathroom or wherever you may need to go in the middle of the night.
Since melatonin not only helps you to go to sleep but -unlike progesterone- also helps to increase REM sleep, working on keeping the level of this hormone up during the night also may help to assure that your sleep is full of happy dreams.
Let's run through the basics. Sleep is a normal function in most animals. Birds, fish, and mammals (which include humans) all do it. It helps the body to grow new tissue, to repair damage, and to rest. Sleep occurs in stages. Stages 1, 2, and 3 are known as non-REM, or NREM, sleep. The other stage is rapid eye movement, or REM sleep. This is the stage during which most dreaming takes place. The stages occur in a cycle, with 1,2,3, and REM cycling through the night, the amount of time in REM sleep increasing with each cycle.
Pregnancy is one of the times when the body does a great deal of growing. Pregnant or not, if you lose some sleep, you can function, drink coffee to compensate, and make up for the loss over the next night or two. But sleep deprivation day after day makes you sick, and extreme deprivation of sleep even can lead to death. Various studies published between 2007 and 2010 have demonstrated an association between lack of sleep and hypertension -high blood pressure- a major risk factor in heart disease and strokes, the first and third leading causes of death, respectively, in the United States.
Generally, six hours per night is cited as the minimum amount of sleep that most adults need to remain healthy. It is clear that many people need somewhat more than this; it is not so clear that people who claim that five hours per night is enough for them are correct. Most sleep experts agree that if you are pregnant you should get closer to eight hours. That is, if you can. Upon learning of their pregnancy usually a few weeks into the first trimester, many women find that they are not sleeping as well as they did before.
The reason for this is hormonal. During a normal menstrual cycle, the hormones estrogen and progesterone rise and fall in a certain pattern, both hormones being at a low at menstruation. If fertilization takes place, then of course you do not menstruate, but then what happens is that the levels of both hormones begin to rise and climb throughout pregnancy. The interplay between the various hormones and sleep is complex and not understood completely, but a lot is known.
Having a lack of estrogen, for example, is known to contribute to a disorder called sleep apnea, a condition in which breathing is interrupted frequently while sleeping, which also interrupts sleep so that the person doesn't sleep well and is sleepy during the day. Progesterone seems to promote sleep, suggesting that women actually should sleep better as the levels rise throughout pregnancy. Why is this not the case? It turns out that while progesterone makes a woman sleepy in general, it actually may decrease the amount of REM sleep, so that the overall quality of sleep suffers. The implication is that pregnant women would not dream as much as perhaps they ought to dream.
But there is another hormone involved and that is melatonin. Unlike estrogen and progesterone, melatonin is present in women as well as men. We all use it to go to sleep. It comes from the pineal gland in the brain and its release pattern depends of the cycles of light and darkness. These cycles are known as circadian rhythms. When it gets dark at night, your pineal gland begins to send melatonin coursing through your blood stream. This makes you sleepy and keeps you asleep throughout the night. The only problem is that, in modern society, often we interrupt circadian rhythms when we fly quickly between multiple time zones, and also when we keep the lights on late into the night. Not only does this make it more difficult to fall asleep but seems to have been a factor at play in the increased incidence of certain cancers during the 20th century as the use of electric light bulbs increased.
Keeping the lights on at night in the hour or two before you go to bed prevents your pineal gland from releasing melatonin to put you to sleep. While the increased progesterone of pregnancy may help you to feel sleepy and may induce non-REM sleep, it also increases your need to urinate, thus waking you up. If you get the lights off and thus get your melatonin turned on, it doesn't take much to turn it off. Turning on a light, for instance to go to the bathroom, even for a couple of minutes, can stimulate your pineal gland to shut off. While this can be helpful in the morning so that the light wakes you up, in the middle of the night it can mean trouble.
Studies have shown that it can take a long time to turn your melatonin back on in the middle of the night once exposure to a small amount of light signals the pineal gland to turn it off. On the other hand, it turns out that not all light turns off your melatonin. Only light at wavelengths less than about 520 nanometers or so -light in the blue and partly into the green part of the light spectrum- turns it off. This means that the price of keeping you melatonin up throughout the night is not having to bump into walls or having to feel your way around in the dark go to the bathroom. It simply means that you need only avoid the blue-green light at night (and avoid white light, which includes all of the colors), replacing it with red light, yellow light, or orange light in the bathroom or wherever you may need to go in the middle of the night.
Since melatonin not only helps you to go to sleep but -unlike progesterone- also helps to increase REM sleep, working on keeping the level of this hormone up during the night also may help to assure that your sleep is full of happy dreams.
Space Suits, Extravehicular Activity, and Underwater Training for Astronauts
A major reason why work is so difficult while wearing a space suit is the air pressure that must be maintained inside the suit. This makes it particularly difficult to move hands and fingers. Through the era of the space shuttle/International Space Station (ISS), space suits were designed to use pressures as low as possible. The drawback to a low pressure suit, however, is that astronauts preparing for a space walk must “pre-breath” pure oxygen for 2-4 hours (depending on whether they are exercising) or the pressure inside the space shuttle must be reduced prior to the space walk, in order to avoid decompression sickness resulting from nitrogen bubbles forming in the blood. This is one of the numerous physiological complications associated with human spaceflight. Thus, engineers are trying to develop higher pressure suits with particular emphasis on the fingers of the gloves.
“Walking “ in space is known as extravehicular activity (EVA). An important part of EVA training takes place underwater. For ISS-related activity, such underwater training takes place in NASA’s Neutral Buoyancy Laboratory (NBL). The NBL is an enormous pool, the largest ever built. Underwater in the NBL are mock-ups of ISS components, or whatever craft or components astronauts will be operating from, or on, during the EVA for which they are training. The Russian Federal Space Agency, Roscosmos, has a similar, though smaller, facility with mock-ups. It is used for astronauts and cosmonauts training to use the Russian space suits. Typically an astronaut spends 10 hours in the NBL for every hour that will be spent in EVA. Astronauts wearing space suits perform dive, assisted by professional divers in the pool who are diving with SCUBA equipment. During each simulated EVA, some divers are assigned to monitor and assist with equipment, while others provide direct assistance to astronauts or to others who are diving in space suits (sometimes non-astronauts have the opportunity to dive wearing a space suit, generally for research purposes).
If you examine the photograph, you will notice that at least seven divers are visible in proximity to the two people who are wearing space suits. Notice that one diver has his arm around the umbilical of one of the space suits. One of the many tasks that the NBL divers perform is to make sure that these umbilicals do not become entangled with one another or with equipment. Unlike during an actual EVA, when suits are pressurized from tanks attached directly to the suit, while in the NBL suits are pressurized through these umbilicals. Since the training takes place at depth, the pressure maintained inside the suits is much higher than the normal pressure at the Earth’s surface, while in space during an EVA, the pressure inside the suits is much lower than normal. This difference has important implications vis-à-vis the measures taken to prevent decompression sickness in the NBL vs. EVA situations.
“Walking “ in space is known as extravehicular activity (EVA). An important part of EVA training takes place underwater. For ISS-related activity, such underwater training takes place in NASA’s Neutral Buoyancy Laboratory (NBL). The NBL is an enormous pool, the largest ever built. Underwater in the NBL are mock-ups of ISS components, or whatever craft or components astronauts will be operating from, or on, during the EVA for which they are training. The Russian Federal Space Agency, Roscosmos, has a similar, though smaller, facility with mock-ups. It is used for astronauts and cosmonauts training to use the Russian space suits. Typically an astronaut spends 10 hours in the NBL for every hour that will be spent in EVA. Astronauts wearing space suits perform dive, assisted by professional divers in the pool who are diving with SCUBA equipment. During each simulated EVA, some divers are assigned to monitor and assist with equipment, while others provide direct assistance to astronauts or to others who are diving in space suits (sometimes non-astronauts have the opportunity to dive wearing a space suit, generally for research purposes).
If you examine the photograph, you will notice that at least seven divers are visible in proximity to the two people who are wearing space suits. Notice that one diver has his arm around the umbilical of one of the space suits. One of the many tasks that the NBL divers perform is to make sure that these umbilicals do not become entangled with one another or with equipment. Unlike during an actual EVA, when suits are pressurized from tanks attached directly to the suit, while in the NBL suits are pressurized through these umbilicals. Since the training takes place at depth, the pressure maintained inside the suits is much higher than the normal pressure at the Earth’s surface, while in space during an EVA, the pressure inside the suits is much lower than normal. This difference has important implications vis-à-vis the measures taken to prevent decompression sickness in the NBL vs. EVA situations.
Labels:
astronauts,
cosmonauts,
decompression sickness,
EVA,
extravehicular activity,
international space station,
ISS,
NASA,
NBL,
Neutral Buoyancy Laboratory,
Roscosmos,
SCUBA,
Soyuz,
underwater training
Aristarchus of Samos, the Heliocentric model, the Seven-Day Week, and the History of Planets
The definition of a planet has changed over the course of numerous, and during the last 100 years. At some point in the Stone Age - it is impossible to know when or where- people noticed that a few of the points of light in the night sky moved with respect to the numerous others. Planets moving in relation to the stars is very difficult to detect in the course of a few hours in a single evening. From night to night, however, the movement of a planet can be very obvious, particularly for the inner planets: Mercury, Venus, and Mars. Planets, as well of the moon, appear in the sky in a band of constellations known as the Zodiac. Because the inclination of the moon’s orbit around Earth is only 5.5 degrees with respect to Earth’s equator, and because Earth and other planets orbit inclined within a few degrees of one another, and inclined within several degrees of the Sun’s equator, the Zodiac is a band running several degrees on either side of the ecliptic, the path that the Sun appears to take through the sky. Thus, from medium and high latitudes of the Northern Hemisphere, the Zodiac constellations and the planets and Moon appear to the south, while they appear to the north from the Southern Hemisphere.
The planets Uranus and Neptune would remain unknown to humanity until discovered the years 1781 CE and 1846 CE, respectively, but the movements of Venus, Jupiter, Mars, Mercury, and Saturn all were observed in detail throughout ancient times; not only are these planets visible to the naked eye, Venus and Jupiter are strikingly bright. So conspicuous for their movement in relation to what came to be known as the "fixed stars", these five planets were awarded special status in ancient civilizations throughout the world. Together with the Sun and Moon, they constituted seven wanderers through Earth’s skies. And since each of these bodies was thought to be -or to be controlled by- a god or goddess, the number seven was considered sacred by cultures around the world. This is the reason for developments such as the seven day week, and the seven branched menorah and Sabbath in ancient Israel. There, the third brightest object in the sky (after the Sun and Moon), which the Romans equated with the goddess Venus, was associated with the Hebrew fertility goddess, Asherah, just as the Greeks associated it with Aphrodite. Although Judaism came to be dominated by monotheistic priests, and later rabbis, who still deny Israel’s service to seven sky deities in ancient times, such a history is fairly obvious, given the emphasis that Israelite and Judahite writings and iconography placed on the number seven -not to mention the Bible’s notation that King Solomon worshipped celestial bodies at the temple whose foundation traditionally is attributed to him.
For countless ages, even the most practiced astronomers assumed that all objects in the sky revolved around Earth. It was not until the 3rd century BCE that Ionian Greek, Aristarchus of Samos, proposed the heliocentric model. In addition to proposing that the Earth moved around the Sun, he proposed that the Sun was six to seven times wider than Earth, which is to say hundreds of times larger in volume. Aristarchus’ writings were among the works of the ancient world lost when the Library of Alexandria was burned during the 4th century CE Information known about Aristarchus comes from writings of some of his contemporaries, particularly Archimedes. Based on these writings, some scholars believe that Aristarchus first concluded that the Sun was much larger than Earth, then based on this idea reasoned that it made no sense for a larger body to orbit a smaller body. For many centuries, Aristarchus’ heliocentric model was ignored and even forgotten, until revived by Copernicus, in the 16th century CE.
The advent of telescope-based astronomy by Galileo led not only to the discovery of the two large planets Uranus and Neptune, but also to a great deal of rethinking about what should be called a planet. For about 50 years, Ceres, which orbits the Sun between the orbits of Mars and Jupiter (thus in the asteroid belt), was called a planet. Later, it was called an asteroid, then finally it was classified as a dwarf planet; unlike an asteroid, Ceres is massive enough so that its gravity has pulled into a spherical shape. Similarly, Pluto was called a planet from 1930-2006, though it too now is classified among the dwarf planets, which though spherical are not massive enough to clear their orbits around the Sun of other bodies. For those who may be upset about Pluto’s demotion, keep in mind that were Pluto to be called a planet, several other bodies would have to be called planets as well. In the 1820s, astronomers listed eleven planets: Mercury, Venus, Earth, Mars, Jupiter, Saturn, and Uranus (Neptune had not been discovered yet), plus Ceres, Vesta, Juno, and Pallas. Various celestial bodies have been discovered, around the size of Pluto, or larger, as in the case of the dwarf planet, Eris. Today, all of these would have had to be called planets, if Pluto were called a planet, since they are massive enough to be spherical. Like Pluto, however, they are not large enough to clear their path of other objects. Currently, astronomers classify five objects as dwarf planets: Ceres, Haumea, Makemake, Eris, and Pluto. It is expected that this number will grow as more celestial bodies are studied in more detail, so that at some point, the Solar System will include seven dwarfs.
The planets Uranus and Neptune would remain unknown to humanity until discovered the years 1781 CE and 1846 CE, respectively, but the movements of Venus, Jupiter, Mars, Mercury, and Saturn all were observed in detail throughout ancient times; not only are these planets visible to the naked eye, Venus and Jupiter are strikingly bright. So conspicuous for their movement in relation to what came to be known as the "fixed stars", these five planets were awarded special status in ancient civilizations throughout the world. Together with the Sun and Moon, they constituted seven wanderers through Earth’s skies. And since each of these bodies was thought to be -or to be controlled by- a god or goddess, the number seven was considered sacred by cultures around the world. This is the reason for developments such as the seven day week, and the seven branched menorah and Sabbath in ancient Israel. There, the third brightest object in the sky (after the Sun and Moon), which the Romans equated with the goddess Venus, was associated with the Hebrew fertility goddess, Asherah, just as the Greeks associated it with Aphrodite. Although Judaism came to be dominated by monotheistic priests, and later rabbis, who still deny Israel’s service to seven sky deities in ancient times, such a history is fairly obvious, given the emphasis that Israelite and Judahite writings and iconography placed on the number seven -not to mention the Bible’s notation that King Solomon worshipped celestial bodies at the temple whose foundation traditionally is attributed to him.
For countless ages, even the most practiced astronomers assumed that all objects in the sky revolved around Earth. It was not until the 3rd century BCE that Ionian Greek, Aristarchus of Samos, proposed the heliocentric model. In addition to proposing that the Earth moved around the Sun, he proposed that the Sun was six to seven times wider than Earth, which is to say hundreds of times larger in volume. Aristarchus’ writings were among the works of the ancient world lost when the Library of Alexandria was burned during the 4th century CE Information known about Aristarchus comes from writings of some of his contemporaries, particularly Archimedes. Based on these writings, some scholars believe that Aristarchus first concluded that the Sun was much larger than Earth, then based on this idea reasoned that it made no sense for a larger body to orbit a smaller body. For many centuries, Aristarchus’ heliocentric model was ignored and even forgotten, until revived by Copernicus, in the 16th century CE.
The advent of telescope-based astronomy by Galileo led not only to the discovery of the two large planets Uranus and Neptune, but also to a great deal of rethinking about what should be called a planet. For about 50 years, Ceres, which orbits the Sun between the orbits of Mars and Jupiter (thus in the asteroid belt), was called a planet. Later, it was called an asteroid, then finally it was classified as a dwarf planet; unlike an asteroid, Ceres is massive enough so that its gravity has pulled into a spherical shape. Similarly, Pluto was called a planet from 1930-2006, though it too now is classified among the dwarf planets, which though spherical are not massive enough to clear their orbits around the Sun of other bodies. For those who may be upset about Pluto’s demotion, keep in mind that were Pluto to be called a planet, several other bodies would have to be called planets as well. In the 1820s, astronomers listed eleven planets: Mercury, Venus, Earth, Mars, Jupiter, Saturn, and Uranus (Neptune had not been discovered yet), plus Ceres, Vesta, Juno, and Pallas. Various celestial bodies have been discovered, around the size of Pluto, or larger, as in the case of the dwarf planet, Eris. Today, all of these would have had to be called planets, if Pluto were called a planet, since they are massive enough to be spherical. Like Pluto, however, they are not large enough to clear their path of other objects. Currently, astronomers classify five objects as dwarf planets: Ceres, Haumea, Makemake, Eris, and Pluto. It is expected that this number will grow as more celestial bodies are studied in more detail, so that at some point, the Solar System will include seven dwarfs.
How DNA Matching Was Used to Identify the Body of Osama Bin Laden
Last month, President Obama announced to the world that, after nearly 10 years, Osama bin Laden, had been found, and killed by United States special forces. Since, apparently, the leader of Al Qaeda had resisted capture, a fire fight broke out, during which he was killed and his body taken into custody. It was an announcement that shook the world. During the president’s speech, Twitter reported that tweets were being posted at a rate of 4,000 per second, and surely, the president would not have ventured to make such an announcement had he not been 100 percent certain, or nearly so, that the body was indeed that of Osama bin Laden, and not a double. What made the president, the FBI, and all government agencies that needed to know certain?
DNA matching: This is some thing that most people have heard about in connection with criminal cases and on numerous detective shows. But how does it work and how was the FBI able to use the technique to confirm the identity of the body presumed to be Osama bin Laden?
What is DNA?
DNA is short for deoxyribonucleic acid. It is an enormously long molecule of repeating units, known as nucleotides. A nucleotide is consists of a nitrogenous base bound to the sugar deoxyribose and bound to other nucleotides by way of connections known as phospho-diester bonds. Each chromosome in your cells consists of one long DNA molecule, which makes use of four DNA nucleotides, which are differentiated based on which of four nitrogenous bases they contain. Adenine (A) and guanine (G) are known as purine bases, while cytosine (C) and thymine (T) are known pyrimidine bases. DNA molecules exist as coiled double strands (known as a double helix) that are joined together through "base pairing" in which A of one strand binds with T of the opposite strand, and G of one strand binds with C of the other strand.
Identification of DNA sequences is based on the precise order of the four DNA nucleotides. For instance, a strand may have a sequence such as: GATTGCCTCTACCATGGGAGGTCGAC…and so on. The purpose of the sequence is to code for the synthesis of another type of long molecule, known as ribonucleic acid (RNA) which functions in the synthesis of proteins. Individual sections of a strand of DNA of chromosomes are known as genes, while one’s entire genetic makeup is known as one’s genome.
While the genomes of any two humans are nearly identical (indeed, between all humans are our closest relative, chimpanzees, 97-99 percent of DNA sequences are shared), no individuals share 100 percent of their genetic sequences, with the exception of identical twins. Thus, assuming that an individual requiring identification does not have an identical twin, his or her genome is unique. For this reason, on detective shows, detectives are always looking for blood, hair, or other small amounts of tissue that may contain cells- and therefore samples of DNA- of a possible suspect, or victim.
The the genome of all humans is nearly identical, it’s a small fraction of a percent of the genome that determines whether the DNA sequences of a sample matches those of a person, body, or other sample.
Although identical twins have identical genomes, people from the same family, siblings for example, share more of that variable fraction of a percent of the entire human genome. Thus, tissue from relatives can be used in DNA identification of remains. Now, it turns out that Osama bin Laden’s sister died in Boston, and that Massachusetts General Hospital had brain tissue from her in frozen storage. After extracting DNA from the brain tissue of bin Laden’s sister, investigators used techniques that used to take many years, but that today take a matter of hours (and the FBI may have methods that work even more quickly). Using such techniques, a long nucleotide sequence was elucidated and compared to that elucidated from DNA extracted from tissues of the body presumed to belong to Osama. The result showed a sequence similarity appropriate for siblings. In other words, the United States has evidence that, with a confidence of more than 99.9 percent, the body of the man killed in yesterday’s raid is indeed a brother of Osama bin Laden’s sister.
Could it be his brother? Well..theoretically, yes. The bin Ladens are a big family, but nobody was worried that the Al Qaeda leader would use his own brother as a double. Thus, the identification was made, and announced.
DNA matching: This is some thing that most people have heard about in connection with criminal cases and on numerous detective shows. But how does it work and how was the FBI able to use the technique to confirm the identity of the body presumed to be Osama bin Laden?
What is DNA?
DNA is short for deoxyribonucleic acid. It is an enormously long molecule of repeating units, known as nucleotides. A nucleotide is consists of a nitrogenous base bound to the sugar deoxyribose and bound to other nucleotides by way of connections known as phospho-diester bonds. Each chromosome in your cells consists of one long DNA molecule, which makes use of four DNA nucleotides, which are differentiated based on which of four nitrogenous bases they contain. Adenine (A) and guanine (G) are known as purine bases, while cytosine (C) and thymine (T) are known pyrimidine bases. DNA molecules exist as coiled double strands (known as a double helix) that are joined together through "base pairing" in which A of one strand binds with T of the opposite strand, and G of one strand binds with C of the other strand.
Identification of DNA sequences is based on the precise order of the four DNA nucleotides. For instance, a strand may have a sequence such as: GATTGCCTCTACCATGGGAGGTCGAC…and so on. The purpose of the sequence is to code for the synthesis of another type of long molecule, known as ribonucleic acid (RNA) which functions in the synthesis of proteins. Individual sections of a strand of DNA of chromosomes are known as genes, while one’s entire genetic makeup is known as one’s genome.
While the genomes of any two humans are nearly identical (indeed, between all humans are our closest relative, chimpanzees, 97-99 percent of DNA sequences are shared), no individuals share 100 percent of their genetic sequences, with the exception of identical twins. Thus, assuming that an individual requiring identification does not have an identical twin, his or her genome is unique. For this reason, on detective shows, detectives are always looking for blood, hair, or other small amounts of tissue that may contain cells- and therefore samples of DNA- of a possible suspect, or victim.
The the genome of all humans is nearly identical, it’s a small fraction of a percent of the genome that determines whether the DNA sequences of a sample matches those of a person, body, or other sample.
Although identical twins have identical genomes, people from the same family, siblings for example, share more of that variable fraction of a percent of the entire human genome. Thus, tissue from relatives can be used in DNA identification of remains. Now, it turns out that Osama bin Laden’s sister died in Boston, and that Massachusetts General Hospital had brain tissue from her in frozen storage. After extracting DNA from the brain tissue of bin Laden’s sister, investigators used techniques that used to take many years, but that today take a matter of hours (and the FBI may have methods that work even more quickly). Using such techniques, a long nucleotide sequence was elucidated and compared to that elucidated from DNA extracted from tissues of the body presumed to belong to Osama. The result showed a sequence similarity appropriate for siblings. In other words, the United States has evidence that, with a confidence of more than 99.9 percent, the body of the man killed in yesterday’s raid is indeed a brother of Osama bin Laden’s sister.
Could it be his brother? Well..theoretically, yes. The bin Ladens are a big family, but nobody was worried that the Al Qaeda leader would use his own brother as a double. Thus, the identification was made, and announced.
Subscribe to:
Posts (Atom)

