Last month, President Obama announced to the world that, after nearly 10 years, Osama bin Laden, had been found, and killed by United States special forces. Since, apparently, the leader of Al Qaeda had resisted capture, a fire fight broke out, during which he was killed and his body taken into custody. It was an announcement that shook the world. During the president’s speech, Twitter reported that tweets were being posted at a rate of 4,000 per second, and surely, the president would not have ventured to make such an announcement had he not been 100 percent certain, or nearly so, that the body was indeed that of Osama bin Laden, and not a double. What made the president, the FBI, and all government agencies that needed to know certain?
DNA matching: This is some thing that most people have heard about in connection with criminal cases and on numerous detective shows. But how does it work and how was the FBI able to use the technique to confirm the identity of the body presumed to be Osama bin Laden?
What is DNA?
DNA is short for deoxyribonucleic acid. It is an enormously long molecule of repeating units, known as nucleotides. A nucleotide is consists of a nitrogenous base bound to the sugar deoxyribose and bound to other nucleotides by way of connections known as phospho-diester bonds. Each chromosome in your cells consists of one long DNA molecule, which makes use of four DNA nucleotides, which are differentiated based on which of four nitrogenous bases they contain. Adenine (A) and guanine (G) are known as purine bases, while cytosine (C) and thymine (T) are known pyrimidine bases. DNA molecules exist as coiled double strands (known as a double helix) that are joined together through "base pairing" in which A of one strand binds with T of the opposite strand, and G of one strand binds with C of the other strand.
Identification of DNA sequences is based on the precise order of the four DNA nucleotides. For instance, a strand may have a sequence such as: GATTGCCTCTACCATGGGAGGTCGAC…and so on. The purpose of the sequence is to code for the synthesis of another type of long molecule, known as ribonucleic acid (RNA) which functions in the synthesis of proteins. Individual sections of a strand of DNA of chromosomes are known as genes, while one’s entire genetic makeup is known as one’s genome.
While the genomes of any two humans are nearly identical (indeed, between all humans are our closest relative, chimpanzees, 97-99 percent of DNA sequences are shared), no individuals share 100 percent of their genetic sequences, with the exception of identical twins. Thus, assuming that an individual requiring identification does not have an identical twin, his or her genome is unique. For this reason, on detective shows, detectives are always looking for blood, hair, or other small amounts of tissue that may contain cells- and therefore samples of DNA- of a possible suspect, or victim.
The the genome of all humans is nearly identical, it’s a small fraction of a percent of the genome that determines whether the DNA sequences of a sample matches those of a person, body, or other sample.
Although identical twins have identical genomes, people from the same family, siblings for example, share more of that variable fraction of a percent of the entire human genome. Thus, tissue from relatives can be used in DNA identification of remains. Now, it turns out that Osama bin Laden’s sister died in Boston, and that Massachusetts General Hospital had brain tissue from her in frozen storage. After extracting DNA from the brain tissue of bin Laden’s sister, investigators used techniques that used to take many years, but that today take a matter of hours (and the FBI may have methods that work even more quickly). Using such techniques, a long nucleotide sequence was elucidated and compared to that elucidated from DNA extracted from tissues of the body presumed to belong to Osama. The result showed a sequence similarity appropriate for siblings. In other words, the United States has evidence that, with a confidence of more than 99.9 percent, the body of the man killed in yesterday’s raid is indeed a brother of Osama bin Laden’s sister.
Could it be his brother? Well..theoretically, yes. The bin Ladens are a big family, but nobody was worried that the Al Qaeda leader would use his own brother as a double. Thus, the identification was made, and announced.